A geneticist isolates a gene for a specific traits under study, she also isolate the corresponding $mRNA$. Upon comparison, the $mRNA$ is found to contain $1,000$ fewer bases than the $DNA$ sequence. Did the geneticist isolate the wrong $DNA$?
A geneticist isolates a gene for a specific traits under study, she also isolate the corresponding $mRNA$. Upon comparison, the $mRNA$ is found to contain $1,000$ fewer bases than the $DNA$ sequence. Did the geneticist isolate the wrong $DNA$?
- A
Yes, $mRNA$ is made from a $DNA$ template and should be the same length as the gene sequence.
- B
Yes, the $mRNA$ should contain more bases than the $DNA$ sequence because bases flanking the gene are also transcribed.
- C
No, the final $mRNA$ contains only exons, the introns were removed.
- D
No, the $mRNA$ was partially degraded after it was transcribed.
Similar Questions
$A$ : $5\;S rRNA$ and surrounding protein complex provides binding site of $tRNA$.
$R$ : $tRNA$ is soluble $RNA$ with unusual bases
$A$ : $5\;S rRNA$ and surrounding protein complex provides binding site of $tRNA$.
$R$ : $tRNA$ is soluble $RNA$ with unusual bases
$m\, -$ $RNA$ is formed by
$m\, -$ $RNA$ is formed by
- [AIIMS 2019]
The equivalent of a structural gene is
The equivalent of a structural gene is
- [NEET 2016]
Which option is matched with figure ?
Which option is matched with figure ?
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
- [NEET 2023]