Full Forms : $mRNA$ & $tRNA$
messenger $RNA$ & transfer $RNA$
Which $RNA$ carries information from $DNA$ in protein synthesis
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
When a mature $mRNA$ was hybridised to its gene certain loops were observed. These loops represent
Definitions/Explanation : Gene & Split gene
It works as enzyme in bacteria.
Confusing about what to choose? Our team will schedule a demo shortly.
