Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

Do you think that the alternate splicing of exons may enable a structural gene to code for several isoproteins from one and the same gene ? If yes, how ? If not, why so ?

Which enzyme plays important role in transcription

A transcription unit in $DNA$ is defined primarily by the three regions in $DNA$ and these are with respect to upstream and down stream end;

If the sequence of one strand of $DNA$ is written as follows:

$5'- ATGCATGCATGCATGCATGCATGCATGC-3'$

Write down the sequence of complementary strand in $5^{\prime} \rightarrow 3^{\prime}$ direction