Explain different types of $RNA$ and Explain the process of transcription.
What are the functions of $(i)$ methylated guanasine cap, $(ii)$ poly $-A$ “tail” in a mature on $RNA $ ?
Which of the following is not region of transcription unit?
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
How many types of ribonucleic acids are known
Confusing about what to choose? Our team will schedule a demo shortly.