Removal of RNA polymerase III from nucleoplasm will affect synthesis of

English

Gujarati

Hindi

5.Molecular Basis of Inheritance

medium

Removal of $RNA$ polymerase $III$ from nucleoplasm will affect the synthesis of

$tRNA$

$hnRNA$

$mRNA$

$rRNA.$

(AIPMT-2012)

Solution

(a) : In eukaryotes, $RNA$ polymerase enzymes (Type $I, II, III$) catalyze the synthesis of $RNA$ using as a template either an existing $DNA$ strand or an $RNA$ strand. Type I is responsible for synthesis of $rRNA$, type $II$ for $mRNA$ and type $III$ for $tRNA$ synthesis.

Standard 12

Biology

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?

medium

(NEET-2023)

$DNA$-dependent $RNA$ polymerase catalyses transcription on one strand of the $DNA$ which is called the

medium

(NEET-2016)

Identification and binding of $RNA$ polymerase to the promoter sequence is a function of

medium

Explain (in one or two lines) the function of the followings:

$(a)$ Promoter

$(b)$ $tRNA$

$(c)$ Exons

easy

$A$ : $RNA$ polymerase is of three types in eukaryotes for the synthesis of all types of $RNAs$.
$R$ : $RNA$ polymerase consists of six types of polypeptides alongwith rho factor which is involved in termination of
$RNA$ synthesis.

medium

Removal of $RNA$ polymerase $III$ from nucleoplasm will affect the synthesis of

Solution

Similar Questions

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?

$DNA$-­dependent $RNA$ polymerase catalyses transcription on one strand of the $DNA$ which is called the

Identification and binding of $RNA$ polymerase to the promoter sequence is a function of

Explain (in one or two lines) the function of the followings: $(a)$ Promoter $(b)$ $tRNA$ $(c)$ Exons

$A$ : $RNA$ polymerase is of three types in eukaryotes for the synthesis of all types of $RNAs$. $R$ : $RNA$ polymerase consists of six types of polypeptides alongwith rho factor which is involved in termination of $RNA$ synthesis.

Start a Free Trial Now

$DNA$-dependent $RNA$ polymerase catalyses transcription on one strand of the $DNA$ which is called the

Explain (in one or two lines) the function of the followings:

$(a)$ Promoter

$(b)$ $tRNA$

$(c)$ Exons

$A$ : $RNA$ polymerase is of three types in eukaryotes for the synthesis of all types of $RNAs$.
$R$ : $RNA$ polymerase consists of six types of polypeptides alongwith rho factor which is involved in termination of
$RNA$ synthesis.