In tailing, adenylate residues are added at $3'$ end
In tailing, adenylate residues are added at $3'$ end
- A
With the help of gyanyl transferase
- B
In a template independent manner
- C
With the help of methyl transferase
- D
Of hn-$RNA$ of $E.$coli
Similar Questions
Which of the following is nongenetic, which is utilised for protein synthesis
Which of the following is nongenetic, which is utilised for protein synthesis
- [AIIMS 1998]
$DNA$-dependent $RNA$ polymerase catalyses transcription on one strand of the $DNA$ which is called the
$DNA$-dependent $RNA$ polymerase catalyses transcription on one strand of the $DNA$ which is called the
- [NEET 2016]
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
- [NEET 2023]
$A$ : $5\;S rRNA$ and surrounding protein complex provides binding site of $tRNA$.
$R$ : $tRNA$ is soluble $RNA$ with unusual bases
$A$ : $5\;S rRNA$ and surrounding protein complex provides binding site of $tRNA$.
$R$ : $tRNA$ is soluble $RNA$ with unusual bases
Splicing of $RNA$ means......
Splicing of $RNA$ means......